pgpH [2020-07-01 16:43:36]

c-di-AMP specific phosphodiesterase

locus: BSU_25330

pI: 7.70

mw: 78.98 kDa

protein length: 711 aa

gene length: 2136 bp

function: control of c-di-AMP homeostasis

product: c-di-AMP specific phosphodiesterase

essential: no

synonyms: yqfF

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
• [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 2,612,282 2,614,417

Phenotypes of a mutant

• a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant acquires suppressor mutations in ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' [Pubmed|26240071]
• a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant is defective in [SW|biofilm formation] [Pubmed|27252699]
• altered morphology on MSgg medium [pubmed|29588402]
• suppresses the growth defect of [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] mutants on gluconeogenic substrates [Pubmed|16272399]

The protein

Catalyzed reaction/ biological activity

• hydrolysis of c-di-AMP to 5'-pApA [Pubmed|25583510]
• 3',3'-c-di-AMP + H₂O --> 5'-O-phosphonoadenylyl-(3'→5')-adenosine + H⁺ (according to UniProt)

Protein family

• PgpH phosphodiesterase family (single member, according to UniProt)

[SW|Domains]

• [SW|HD domain] (aa 501-643) (according to UniProt)

[SW|Cofactors]

• Mn²⁺ [Pubmed|25583510]

Effectors of protein activity

• ppGpp acts as allosteric inhibitor of phosphodiesterase activity (in ''Listeria monocytogenes'') [Pubmed|25583510]

Structure

• [PDB|4S1B] (the HD domain of the protein from ''Listeria monocytogenes'' in complex with c-di-AMP, 58% identity, 85% similarity) [Pubmed|25583510]

[SW|Localization]

• cell membrane [Pubmed|25583510]

Biological materials

Mutant

• MGNA-C432 (yqfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2430 NBRP B. subtilis, Japan]
• SM-GN1 (''pgpH-spc''), available in [SW|Anne Galinier]'s and [SW|Boris Görke]'s labs [pubmed|16272399]
• BKE25330 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
• GP2033 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''tet'', available in [SW|Jörg Stülke]'s lab)
• GP2034 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [SW|Jörg Stülke]'s lab) [Pubmed|26240071]
• GP2040 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc'' ''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [SW|Jörg Stülke]'s lab) [Pubmed|26240071]
• GP2049 (''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''cat'' without terminator, available in [SW|Jörg Stülke]'s lab)
• BKE25330 ([gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA, downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
• BKK25330 ([gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA, downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA

lacZ fusion

• pGP190 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

labs

• [SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]

References

Reviews

• 25637595,25869574,26773214,30224435,32472931

Original publications

• 21630458,25583510,26240071,27252699,29588402,16272399